| HOME | HELP | FEEDBACK | TABLE OF CONTENTS | ARCHIVE | SUBSCRIPTIONS |
|
|
|
||||||
|
||||||||
Lymphoproliferative Disorders |
1 INSERM, E0210, Hôpital Necker, Paris
2 Service d’Hematologie Biologique, Groupe Hospitalier Pitie-Salpetriere, Paris
3 Laboratoire d’Hématologie, CHU Purpan, Toulouse
4 Université Pierre et Marie Curie, Paris VI
5 Université Rene Descartes, Paris V, France
Correspondence: Florence Nguyen-Khac, Service d’Hematologie Biologique Groupe Hospitalier Pitié-Salpetriére, Pavillon Laveran, 47-83 Bd de l’Hopital, 75013 Paris, France. E-mail:florence.nguyen{at}psl.aphp.fr.
 |
ABSTRACT |
|---|
 TOP ABSTRACT IntroductionResults and DiscussionReferences |
|---|
gene on chromosome 14q11. Expression of the CSX1/NKX2-5 protein conferred enhanced replating potential to transduced murine bone marrow cells. Our study establishes that deregulation of homeobox encoding genes is not restricted to acute leukemic proliferations, but is also observed in chronic malignant diseases.
Key words: chromosomal translocation, homeobox, transcriptional activation, chronic lymphocytic leukemia.
|
Introduction |
|---|
|
TOPABSTRACTIntroductionResults and DiscussionReferences |
|---|
One of the major targets in leukemogenesis is the family of homeobox-containing genes which encode DNA-binding proteins. They can be deregulated by various mechanisms, directly or indirectly. Transcriptional deregulation of clustered homeobox genes is observed as an indirect result of chromosomal translocations involving the MLL gene, a regulator of the Trithorax family, or from yet uncharacterized causes in various leukemic subtypes.3 PBX1, an homeobox-cofactor of HOX gene, is fused to the E2A gene by the t(1;19)(q23;p13) translocation of B-cell ALL.4
The HOX11/TLX1 orphan gene family is inappropriately expressed in about 30% of T-ALL samples.5–7 TLX1, located on chromosome 10q24, is ectopically expressed upon its rearrangement with the TCR , or TCR β, chain genes in 10% of T-ALLs. The related HOX11L2/TLX3 gene, located on chromosome 5q35, is rearranged with the TCR gene on chromosome 14 (band q11) in only a few cases of ALL.8 However, it is targeted by the cryptic t(5;14)(q35;q32) translocation, which affects the CTIP2/BCL11B locus on chromosome 14 (band q32) in more than 20% of childhood T-ALLs.9,10 Finally, a new chromosome 5q35 breakpoint has been reported close to the CSX1/NKX2-5 homeobox gene, approximately 2 megabases telomeric to TLX3, which juxtaposes NKX2-5 to BCL11B locus derived sequences in two cell lines11 and to TCRD in a T-ALL patient.12
In a search for additional structural abnormalities of the long arm of chromosome 5, we identified a t(5;14)(q35;q11) translocation in a B-cell chronic lymphoproliferative disorder. We now report the molecular characterization of this translocation and demonstrate the involvement of the TCR gene on chromosome 14 and the NKX2-5 gene on chromosome 5.
Case report
A 49-year-old female was diagnosed with an atypical B-lymphoproliferative disorder with peripheral blood, bone marrow and breast involvement in the Pitié-Salpêtrière hospital in October 1995. Spleen and lymph nodes were not involved. The immunophenotype of peripheral blood lymphocytes was CD22+, FMC7+, CD79b+, CD23–, CD5+ and IgM/D 
high (Matutes’ score 2).13 Apart from CD5, no T-cell markers were expressed. According to current WHO criteria,14 this case could be classified pleomorphic mantle cell lymphoma. After CHOP/CLL type treatment,15 complete remission was observed until May 2000. The lymphocyte count progressively increased, again with the same phenotype and reached 35x109/L with associated anemia. The patient was treated with ESHAP, rituximab and autologous bone marrow transplantation16 and achieved a second durable complete remission which still persists as of September 2007. Informed consent was obtained from the patient and the study was approved by the INSERM review board (October 2005).
Cytogenetic analysis
Chromosome studies using RHG and GTG banding techniques were performed on peripheral blood cells. Description of chromosomal changes followed the ISCN recommendations.17 Metaphase FISH analysis was performed as previously described.18
Nucleic acid methods
RNA and DNA extraction and analyses were performed using standard protocols. Nylon membranes were Hybond N+ (Amersham, Les Ulis, France). Inverse-PCR was performed as previously described19 using inverse primers as follows: external-REV GCAGT-GAGTGAGAGGTCAGCA, external-FOR GACAGT-GAATAATGGCCCTACA, internal-REV GGTCCAGT-CAACTTCCTGCT, and internal-FOR GTTACATTG-CACATGATGACTATA. PCR products were then sequenced. Classical PCR was then used to confirm location and sequence of the breakpoint (FOR GCAAATCAAGGTGGCAAGGA AND REV GCAGT-GAGTGAGAGGTCAGCA).
Sequence analyses were performed locally or at http://genome.ucsc.edu.
A human NKX2-5 HA-tagged expression construct was obtained by PCR amplification of the entire open reading frame, was cloned into the vector pcDNA3, and verified by DNA sequencing.
For RT-PCR analyses, 2 µg of total RNA extracted from patients’ mononuclear bone marrow cells or cell lines were used to synthesize cDNA using the Superscript II kit (Invitrogen, Cergy-Pontoise, France) and random hexamers. PCR amplifications were performed starting from 2 µL of cDNA template for 33 cycles consisting of 94°C for 1 min; 55°C for 30 secs., and 72°C for 30 secs., primers used were as follow: NKX2-5-FOR TCTATCCACGTGCCTACAGC; NKX2-5-REV TGGACGTGAGTTTCAGCACG.
Probes for Southern blot
A probe corresponding to chromosome 5 sequences upstream of NKX2-5, spanning nucleotides 172596357 to 172598356, was obtained by PCR amplification of BAC 281H14 DNA using AAAGACACAGCTCC-CGCAGGC and ACGAAGAGCAGAGTCGCGCT primers. The J 1 probe is a 1.7 kb XbaI fragment spanning nucleotides 21988328 to 21990065 of chromosome.14
Western blot
50 µg of total cellular extracts were separated in 10% SDS-PAGE gel and then blotted to nitrocellulose membranes (Schleicher & Schuell, Cassel, Germany). 1:1,000 Anti NKX2-5 (SC-14033, Santa Cruz, Palo Alto, CA, USA) and 1:2,000 anti-actin (A5316, Sigma Aldrich, St-Quentin-Fallavier, France) antibodies were used.
|
Results and Discussion |
|---|
|
TOPABSTRACTIntroductionResults and DiscussionReferences |
|---|
encompassing probes (Figure 1B). The use of FISH probes aimed at detecting the rearrangement of the TLX3 locus on chromosome 5 resulting from the common t(5;14) translocation showed signals on both normal and rearranged chromosomes 5, indicating that the breakpoint was telomeric to this locus (data not shown). To check for involvement in the NKX2-5 gene, we used BAC 466H21 as a FISH probe. This probe generated a signal on the der(5) and der(14) chromosomes in addition to a signal on the normal chromosome 5 (Figure 1B). Together, these data indicate that the TCRD gene was rearranged within the NKX2-5 locus as a result of this t(5;14) translocation. To establish involvement of the TCRD gene at the molecular level, we used a probe encompassing the J 1 segment in Southern blotting experiments. This probe identified an abnormal fragment in addition to the germline band in DNA digested with either BamHI or BglII (Figure 2A). The same rearrangement was observed at two different stages of the disease (P-1 and P-2). To better characterize the breakpoint on chromosome 5, we used an inverse PCR strategy starting from TCR sequences using DNA from P-1. Analyses of the nucleotide sequence of the amplified fragment located the breakpoint on chromosome 5, 2.5 kb downstream from the NKX2-5 gene (see Online Supplementary Figure 1 for a scheme of the loci). To confirm our result, we selected a probe from this region for Southern blot analyses of the patient’s DNA. The probe detected an abnormal fragment upon digestion with EcoRI in addition to the germline band. This probe also identified an abnormal BglII fragment of similar size to the abnormal fragment detected by the J 1 probe (data not shown). To further compare the two stages of disease, the nucleotide sequence of the breakpoint was determined after PCR amplification of the patient’s DNA and was shown to be identical. Nucleotide sequence alignment of the chromosomal breakpoint with its normal counterpart is shown in Figure 2C. This allowed us to locate the breakpoint on chromosome 14 immediately 5' of the D 3 segment. The sequence of the chromoso mal fusion demonstrated the presence of non-templated (N) nucleotides implicating V(D)J recombinase activity in the genesis of the translocation. On chromosome 5, recombination-related sequences, i.e. a canonical 21 bp spacer between heptamer and nonamer sequences, were observed which might account for the location of the chromosome 5 breakpoint.
|
|
gene rearrangement in a B-type neoplasm is a rare event.20,21 However, since the TCR enhancers are known to be lymphoid specific but not T-cell restricted, the functional consequences of these rearrangements are transcriptional activation of the partner genes. To compare the biological properties of NKX2-5 to those of TLX1 and HOXA9, we used a myeloid colony formation assay. Murine hematopoietic precursors (Linneg/low) were transduced by MSCV based constructs expressing NKX2-5 and plated in methylcellulose. The colonies were scored and compared with empty viruses or viruses encoding HOXA9 or TLX1. All retroviruses were similarly efficient in transduction (data not shown). All three constructs conferred enhanced replating potential to the transduced cells (Figure 3A). The growth stimulatory effect towards myeloid progenitors was more pronounced for HOXA9 and TLX1, but NKX2-5 expression repeatedly conferred to myeloid progenitors the ability to generate colonies after the third round of replating, a feature never observed with empty vector. The moderate effect of NKX2-5 markedly differs from the effect of HOXA9 and is comparable to the effect of TLX3 or HOXA13.22 Homeobox proteins have documented effects on cell survival, proliferation and fate. The three orphan homeobox genes, TLX1, TLX3 and NKX2-5, are known to be transcriptionally activated in T-ALL. During development, TLX1 is involved in genesis of the spleen, and TLX1 and TLX3 play a role in cellular fate determination of some neuron subtypes.23 The cardiac homeobox protein, NKX2-5, is essential to cardiac development and mutations of NKX2-5 cause various congenital heart diseases.24 It would be of interest to identify and compare the oncogenic pathways triggered by those oncoproteins. Ectopic expression of NKX2-5 has also been reported in two T-cell lines derived from T-cell malignant diseases and in a T-ALL patient.12 This report also supports an oncogenic role for NKX2-5. The frequency of HOX gene activation in malignant B-cell diseases must still be determined, keeping in mind that our patient with a t(5;14) translocation exhibited an unusual extranodal disease.
|
gene, the translocation might have occurred at an early step of lymphoid differentiation. Nevertheless, our results demonstrate that homeobox transcriptional activation occurs in both T- and B-lymphoid proliferation and also in both acute and chronic disease.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
XS designed research and perfomed research; VD-V perfomed research; ED provided vital reagents and revised the manuscript; ZA provided vital reagents; RB designed research and revised the manuscript; HM-B provided vital reagents and revised the manuscript; OAB funded research and revised the manuscript; FN-K designed research and wrote the manuscript.
The online version of this article contains a supplementary appendix.
The authors reported no potential conflicts of interest.
Received for publication December 6, 2007. Revision received February 4, 2008. Accepted for publication February 22, 2008.
|
References |
|---|
|
TOPABSTRACTIntroductionResults and DiscussionReferences |
|---|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | TABLE OF CONTENTS | ARCHIVE | SUBSCRIPTIONS |
